| pubmed-article:1339958 | pubmed:abstractText | Using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to C-terminal peptides GGAACTCCCTTTTCTGGATAGCTCACC and CCTGGTCCGAACCCAAACAGGACGCCCC, were used to amplify, via polymerase chain reaction, genomic sequences from two Gossypium species, a diploid Gossypium herbaceum, and a tetraploid Gossypium hirsutum cv. 108F. Amplified DNA was separated into individual sequences by cloning into an M13 vector. Six different sequences were identified in each species. From each set of six, one sequence was found to be identical to the genomic sequence, which we have isolated from a subgenomic library of 108F DNA in lambda NM1149. Comparison of other sequences has allowed to find another pair of identical sequences, as well as to get an evidence, that the set isolated from the tetraploid cotton contained preferentially members of only one of the two subfamilies, probably due to primer specificity in amplification reaction. Comparison of specific amino acid substitutions in homologous sequences of cotton, peanut and soybean also suggested that all of the sequences isolated from cotton are more likely to code for chalcone synthase, that for a similar enzyme resveratrol synthetase. | lld:pubmed |
